ID: 1077136216_1077136231

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1077136216 1077136231
Species Human (GRCh38) Human (GRCh38)
Location 11:1000477-1000499 11:1000498-1000520
Sequence CCCCCTGCCCCCGCGGGCCCCCC CCACCCTCCTCCGGCGGCAGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 114, 4: 1107} {0: 1, 1: 0, 2: 2, 3: 14, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!