ID: 1077136217_1077136225

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1077136217 1077136225
Species Human (GRCh38) Human (GRCh38)
Location 11:1000478-1000500 11:1000492-1000514
Sequence CCCCTGCCCCCGCGGGCCCCCCA GGCCCCCCACCCTCCTCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 634} {0: 1, 1: 0, 2: 1, 3: 28, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!