ID: 1077136219_1077136237

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1077136219 1077136237
Species Human (GRCh38) Human (GRCh38)
Location 11:1000480-1000502 11:1000509-1000531
Sequence CCTGCCCCCGCGGGCCCCCCACC CGGCGGCAGCGGGCTGCTCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 98, 4: 1143} {0: 1, 1: 0, 2: 1, 3: 24, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!