ID: 1077136233_1077136239

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1077136233 1077136239
Species Human (GRCh38) Human (GRCh38)
Location 11:1000501-1000523 11:1000536-1000558
Sequence CCCTCCTCCGGCGGCAGCGGGCT GTTCTCAGACTCGGCCTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 102} {0: 1, 1: 0, 2: 1, 3: 8, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!