ID: 1077152192_1077152200

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1077152192 1077152200
Species Human (GRCh38) Human (GRCh38)
Location 11:1077383-1077405 11:1077396-1077418
Sequence CCGGGAGGACAAGCTGGGGCGGG CTGGGGCGGGGGGGCCTGGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!