ID: 1077212055_1077212069

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1077212055 1077212069
Species Human (GRCh38) Human (GRCh38)
Location 11:1375646-1375668 11:1375699-1375721
Sequence CCGGCGGACAGGATCGTGTCCTT GGCCCGGCCCGAGGAGCCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 51} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!