ID: 1077306740_1077306754

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1077306740 1077306754
Species Human (GRCh38) Human (GRCh38)
Location 11:1871962-1871984 11:1872013-1872035
Sequence CCTGGCGCACGCTGGTAGAGTTG TGGGACGGGGTGTGTGTGGCAGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 1, 3: 13, 4: 73} {0: 4, 1: 4, 2: 8, 3: 58, 4: 614}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!