ID: 1077306762_1077306775

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1077306762 1077306775
Species Human (GRCh38) Human (GRCh38)
Location 11:1872056-1872078 11:1872094-1872116
Sequence CCTGGTGCACGCTGGTAGAGTTG GCGTGGGCACTTTTGGGAGGGGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 2, 3: 7, 4: 90} {0: 3, 1: 3, 2: 5, 3: 19, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!