ID: 1077332940_1077332950

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1077332940 1077332950
Species Human (GRCh38) Human (GRCh38)
Location 11:1991280-1991302 11:1991296-1991318
Sequence CCCCGCTGGCTTCCCTCAGCCCT CAGCCCTGGAAGGGGGCCAACGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 41, 4: 385}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!