ID: 1077334879_1077334888

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1077334879 1077334888
Species Human (GRCh38) Human (GRCh38)
Location 11:1998773-1998795 11:1998815-1998837
Sequence CCCTCTGGGATGTGGAAGGGCTG CTCTGTTCCCATGGCCCCACCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 29, 4: 253} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!