ID: 1077386099_1077386106

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1077386099 1077386106
Species Human (GRCh38) Human (GRCh38)
Location 11:2270245-2270267 11:2270267-2270289
Sequence CCGGGGACGCGGGTCTCCGCCGG GGCAGCGCAGCCGACAGGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 92} {0: 1, 1: 0, 2: 2, 3: 20, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!