ID: 1077412047_1077412062

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1077412047 1077412062
Species Human (GRCh38) Human (GRCh38)
Location 11:2408182-2408204 11:2408217-2408239
Sequence CCAAGATCACAGGCCCTGGAAGT CCTGGAGGGATGGAAGGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 256} {0: 1, 1: 0, 2: 4, 3: 84, 4: 785}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!