ID: 1077412049_1077412068

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1077412049 1077412068
Species Human (GRCh38) Human (GRCh38)
Location 11:2408196-2408218 11:2408240-2408262
Sequence CCTGGAAGTAGAGCCAAGACCCC ACAGAGGGGTCACGGGACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 170} {0: 1, 1: 0, 2: 0, 3: 19, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!