ID: 1077474227_1077474238

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1077474227 1077474238
Species Human (GRCh38) Human (GRCh38)
Location 11:2778845-2778867 11:2778878-2778900
Sequence CCTGCTTCCATCTCGGCTGCAGC GGGCAGGCACAGCCCGGCCCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 22, 4: 245} {0: 1, 1: 0, 2: 3, 3: 83, 4: 550}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!