ID: 1077491088_1077491097

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1077491088 1077491097
Species Human (GRCh38) Human (GRCh38)
Location 11:2861390-2861412 11:2861416-2861438
Sequence CCTCAGGCTGGGTCCGGGGCCCA CCTACAGATGTGCTGGGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 407} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!