ID: 1077513433_1077513434

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1077513433 1077513434
Species Human (GRCh38) Human (GRCh38)
Location 11:2984900-2984922 11:2984917-2984939
Sequence CCTTTATACAGGTTGAGTATCTC TATCTCTTATCTGAAATGCTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 6, 3: 35, 4: 127} {0: 29, 1: 209, 2: 449, 3: 782, 4: 952}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!