|
Left Crispr |
Right Crispr |
| Crispr ID |
1078311813 |
1078311815 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:10251260-10251282
|
11:10251301-10251323
|
| Sequence |
CCTTCACTCTTCTAGAAGGACAT |
TCCATGATTTAGAATAAAAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 14, 1: 31, 2: 46, 3: 37, 4: 217} |
{0: 2, 1: 21, 2: 24, 3: 46, 4: 314} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|