ID: 1078479011_1078479018

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1078479011 1078479018
Species Human (GRCh38) Human (GRCh38)
Location 11:11659986-11660008 11:11660020-11660042
Sequence CCCTAATAGGGATGGGCCTCATC AGGCCTAAACAGCAAAGACTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 54, 3: 255, 4: 676} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!