ID: 1078921881_1078921887

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1078921881 1078921887
Species Human (GRCh38) Human (GRCh38)
Location 11:15838317-15838339 11:15838347-15838369
Sequence CCTTTCAGAGCAGCTACTCCCTG CTGAGTATAAACTCTGGTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 199} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!