ID: 1079750689_1079750692

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1079750689 1079750692
Species Human (GRCh38) Human (GRCh38)
Location 11:24192339-24192361 11:24192366-24192388
Sequence CCTCTCATGACACATGATGATTA AGTTCAAGGTGAGATTTGGATGG
Strand - +
Off-target summary No data {0: 6, 1: 203, 2: 2776, 3: 12932, 4: 13803}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!