ID: 1080027890_1080027893

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1080027890 1080027893
Species Human (GRCh38) Human (GRCh38)
Location 11:27632447-27632469 11:27632461-27632483
Sequence CCGATTTTCAGTGGGGTCCCACA GGTCCCACACAGATGGGACACGG
Strand - +
Off-target summary No data {0: 82, 1: 298, 2: 258, 3: 133, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!