|
Left Crispr |
Right Crispr |
| Crispr ID |
1080076590 |
1080076595 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:28157493-28157515
|
11:28157531-28157553
|
| Sequence |
CCTGACATCTTCTGCAGATAACT |
GACAGCTCTTGGCCTGTTACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 211, 2: 170, 3: 137, 4: 213} |
{0: 162, 1: 189, 2: 129, 3: 114, 4: 178} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|