ID: 1080165227_1080165231

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1080165227 1080165231
Species Human (GRCh38) Human (GRCh38)
Location 11:29227681-29227703 11:29227719-29227741
Sequence CCTGATCCACTGAGAAGGAAACA CTTTCTCCATCTTACGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 28, 4: 262} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!