ID: 1080413682_1080413692

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1080413682 1080413692
Species Human (GRCh38) Human (GRCh38)
Location 11:32050028-32050050 11:32050072-32050094
Sequence CCCACAGGTCCAATCCCATTTGG TCCACTAGCCTAAGAAGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 226} {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!