ID: 1080639297_1080639303

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1080639297 1080639303
Species Human (GRCh38) Human (GRCh38)
Location 11:34149468-34149490 11:34149485-34149507
Sequence CCCAAGCCTGCCTGTGGCTGCTC CTGCTCATAGCAGGCGGAGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!