ID: 1080976678_1080976684

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1080976678 1080976684
Species Human (GRCh38) Human (GRCh38)
Location 11:37350570-37350592 11:37350618-37350640
Sequence CCTGCCATCTTCTGCAGATAACT GGCTTGTTACTGGGCTTTCATGG
Strand - +
Off-target summary {0: 185, 1: 187, 2: 104, 3: 111, 4: 225} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!