ID: 1081222232_1081222239

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1081222232 1081222239
Species Human (GRCh38) Human (GRCh38)
Location 11:40476017-40476039 11:40476055-40476077
Sequence CCCACTAGGTGCCAGTAATACCC CATTGCAAAATGTTCCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 40, 3: 252, 4: 803} {0: 1, 1: 2, 2: 42, 3: 273, 4: 766}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!