ID: 1081536743_1081536756

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1081536743 1081536756
Species Human (GRCh38) Human (GRCh38)
Location 11:44002184-44002206 11:44002210-44002232
Sequence CCAGACCACCGGAAAGGGCCATT GTGGGGGACAGGAGAAGGGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!