ID: 1081734056_1081734064

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1081734056 1081734064
Species Human (GRCh38) Human (GRCh38)
Location 11:45391280-45391302 11:45391302-45391324
Sequence CCTCGGAGCTGGGGAGTGGGGGG GATTGGAGGGCGGTTGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 76, 4: 661} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!