ID: 1081804136_1081804141

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1081804136 1081804141
Species Human (GRCh38) Human (GRCh38)
Location 11:45880981-45881003 11:45881030-45881052
Sequence CCTGCAGAGAAGCTGATCACCGG TGTGTGCGCGTGTGCAGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 81} {0: 1, 1: 1, 2: 8, 3: 99, 4: 865}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!