ID: 1082166420_1082166431

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1082166420 1082166431
Species Human (GRCh38) Human (GRCh38)
Location 11:48955644-48955666 11:48955683-48955705
Sequence CCCAGAAGGGGCAGCTGCCGGGC TCTCAGATGGGGCAGCTGCCGGG
Strand - +
Off-target summary No data {0: 20, 1: 340, 2: 723, 3: 1614, 4: 4108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!