ID: 1082166420_1082166434

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1082166420 1082166434
Species Human (GRCh38) Human (GRCh38)
Location 11:48955644-48955666 11:48955690-48955712
Sequence CCCAGAAGGGGCAGCTGCCGGGC TGGGGCAGCTGCCGGGCGGAGGG
Strand - +
Off-target summary No data {0: 18, 1: 327, 2: 706, 3: 933, 4: 1140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!