ID: 1082698360_1082698362 |
View in Genome Browser |
Spacer: 18 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1082698360 | 1082698362 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 11:56398682-56398704 | 11:56398723-56398745 |
| Sequence | CCTTTTTTATTCTAAACCATGGA | ATGTCCTTCTAGAAGAGTGAAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 14, 1: 31, 2: 46, 3: 37, 4: 217} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||