ID: 1082698360_1082698362

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1082698360 1082698362
Species Human (GRCh38) Human (GRCh38)
Location 11:56398682-56398704 11:56398723-56398745
Sequence CCTTTTTTATTCTAAACCATGGA ATGTCCTTCTAGAAGAGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 19, 2: 25, 3: 54, 4: 353} {0: 14, 1: 31, 2: 46, 3: 37, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!