ID: 1082855154_1082855161

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1082855154 1082855161
Species Human (GRCh38) Human (GRCh38)
Location 11:57799370-57799392 11:57799397-57799419
Sequence CCATCCCTAGTTGTGCTAGTTCA GAGTTTTGGGCCTGGTTCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78} {0: 1, 1: 0, 2: 2, 3: 9, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!