ID: 1082855162_1082855166

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1082855162 1082855166
Species Human (GRCh38) Human (GRCh38)
Location 11:57799407-57799429 11:57799424-57799446
Sequence CCTGGTTCTTGGGTTTGTTCCAG TTCCAGGGTAGCACTGGACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 146} {0: 1, 1: 0, 2: 1, 3: 7, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!