ID: 1083083215_1083083221

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1083083215 1083083221
Species Human (GRCh38) Human (GRCh38)
Location 11:60114711-60114733 11:60114745-60114767
Sequence CCCAGGGGCAGCATGCAGGACCA AAAAAATGCATTAGTGGGATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 50, 4: 545}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!