ID: 1083189085_1083189096

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1083189085 1083189096
Species Human (GRCh38) Human (GRCh38)
Location 11:61036538-61036560 11:61036582-61036604
Sequence CCTGGCAAAGACCACACTGCACA GTGCTGCATAGTGTCCTCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!