ID: 1083347671_1083347674

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1083347671 1083347674
Species Human (GRCh38) Human (GRCh38)
Location 11:62004882-62004904 11:62004909-62004931
Sequence CCATGCATGGATTTTGCTCTTAA TGTCTCTCAGCTGGGCGCAGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!