ID: 1083415185_1083415191

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1083415185 1083415191
Species Human (GRCh38) Human (GRCh38)
Location 11:62520985-62521007 11:62521011-62521033
Sequence CCACATCACCCTTCACCTTGGGA TTCAGGTGCAAATCAAAGTCAGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 3, 3: 25, 4: 226} {0: 1, 1: 4, 2: 2, 3: 13, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!