|
Left Crispr |
Right Crispr |
| Crispr ID |
1083502970 |
1083502974 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:63128450-63128472
|
11:63128479-63128501
|
| Sequence |
CCACCTCTTGTGGAGGGCCTGAC |
CAGGCCCACCTGCAGTTATCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 177, 1: 128, 2: 50, 3: 45, 4: 117} |
{0: 7, 1: 20, 2: 47, 3: 103, 4: 241} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|