ID: 1083593998_1083594001

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1083593998 1083594001
Species Human (GRCh38) Human (GRCh38)
Location 11:63910410-63910432 11:63910445-63910467
Sequence CCTCCACAGGGTGGGGGACAGAT TCCCAGCTTGCTACCCTCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 172} {0: 1, 1: 0, 2: 0, 3: 15, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!