ID: 1083593999_1083594010

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1083593999 1083594010
Species Human (GRCh38) Human (GRCh38)
Location 11:63910413-63910435 11:63910464-63910486
Sequence CCACAGGGTGGGGGACAGATAGG GTGGCCAGTGTGGGCGTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 245} {0: 1, 1: 0, 2: 5, 3: 48, 4: 568}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!