ID: 1083594002_1083594016

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1083594002 1083594016
Species Human (GRCh38) Human (GRCh38)
Location 11:63910446-63910468 11:63910482-63910504
Sequence CCCAGCTTGCTACCCTCAGTGGC GGCGGTTTGGGGCGCTTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 216} {0: 1, 1: 0, 2: 0, 3: 6, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!