ID: 1083713700_1083713716

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1083713700 1083713716
Species Human (GRCh38) Human (GRCh38)
Location 11:64563992-64564014 11:64564037-64564059
Sequence CCAACTCTAGGGACACCCATGCC TGTGCAGGGCTCAGGTGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 119} {0: 1, 1: 0, 2: 2, 3: 77, 4: 666}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!