ID: 1083713702_1083713713

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1083713702 1083713713
Species Human (GRCh38) Human (GRCh38)
Location 11:64564007-64564029 11:64564029-64564051
Sequence CCCATGCCCAGGCCACCTGTGCC CCTGGCTGTGTGCAGGGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 53, 4: 342} {0: 1, 1: 1, 2: 3, 3: 75, 4: 602}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!