ID: 1083854454_1083854459

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1083854454 1083854459
Species Human (GRCh38) Human (GRCh38)
Location 11:65385884-65385906 11:65385909-65385931
Sequence CCCTGGGGTTCACACCATTCTCC CCTCAGCCTTCCCGCGTAGCTGG
Strand - +
Off-target summary {0: 13, 1: 341, 2: 584, 3: 1091, 4: 1727} {0: 1, 1: 101, 2: 603, 3: 1479, 4: 1927}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!