ID: 1084588816_1084588830

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1084588816 1084588830
Species Human (GRCh38) Human (GRCh38)
Location 11:70078700-70078722 11:70078745-70078767
Sequence CCGTCCGAGGGCACGGTGAGTGC AGGGCCGCGCACCTGCGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 63} {0: 1, 1: 0, 2: 1, 3: 14, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!