ID: 1084588827_1084588845

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1084588827 1084588845
Species Human (GRCh38) Human (GRCh38)
Location 11:70078729-70078751 11:70078781-70078803
Sequence CCGCGACCCGGGCGGGAGGGCCG CGGGCGGCGGCAGGGCCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 138} {0: 1, 1: 0, 2: 3, 3: 37, 4: 428}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!