ID: 1084588829_1084588841

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1084588829 1084588841
Species Human (GRCh38) Human (GRCh38)
Location 11:70078736-70078758 11:70078768-70078790
Sequence CCGGGCGGGAGGGCCGCGCACCT CGAGGGCGGGAACCGGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 155} {0: 2, 1: 0, 2: 1, 3: 28, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!