ID: 1084806425_1084806431

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1084806425 1084806431
Species Human (GRCh38) Human (GRCh38)
Location 11:71582365-71582387 11:71582400-71582422
Sequence CCTCAGATCTTACACTGGCAGCA GCAGCTGGACTGGCAGCAGCAGG
Strand - +
Off-target summary {0: 6, 1: 2, 2: 2, 3: 3, 4: 144} {0: 6, 1: 9, 2: 43, 3: 149, 4: 696}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!